DNA Techniques
Fingerprinting VS Sequencing
A fingerprint is unique to a person, so is their DNA fingerprint. A DNA fingerprint is based on the number of non-coding repeats that a person has on an area of a chromosome. This is unique. It is relatively cheap to find a persons DNA fingerprint and to Compare it to others (paternity testing and crime)
Alleles are different versions of a Gene due to differences in the sequence of nucleotides. It is relatively more expensive to find a persons DNA sequence for a particular gene. This Sequencing is for an individual sometimes for breeding (family planning) purposes.
Polymerase Chain Reaction
Regardless if it is Fingerprinting or Sequencing, you need to START with Polymerase Chain Reaction to increase the quantity of DNA you are using.
PCR doesn't amplify all of the DNA sample you have. Just a location you are interested in - eg 1 million copies of a small part of chromosome 2.
Have a play with the this PCR interactive
Watch the short clip below
Gel Electrophoresis
Gel Electrophoresis uses 3 principles.
DNA is negatively charged, so it will be repelled from a negative and pulled toward a positive
DNA can be cut up into small pieces
The gel is like an obstacle course, smaller pieces travel further
In non-coding parts of our DNA we have repeating sequences called Short Tandem Repeats. These are exactly that, eg: GTAGTAGTAGTAGTAGTAGTAGTA.
When these sections are replicated during Meiosis for the creation of Gametes, there is a higher likelihood of errors. Thus it might be
Germ cell: TTAACCGTAGTAGTAGTAGTAGTAGTAGTAGTATTAACC
Gametes: TTAACCGTAGTAGTAGTAGTAGTAGTAGTATTAACC
Notice that the length of this locus is different between the germ cell and the gametes
Thus, you could:
Restriction Enzymes to cut the samples where TTAA occurs - thus you get fragments that start in AA and end in TT
PCR to increase the sample you have (1,000,000 copies of the Parent DNA and 1,000,000 copies of the childs DNA)
Gel Electrophoresis to separate these fragments based on size
DNA Sequencing
DNA sequencing is done to identify what a persons Genotype is. That is what are their alleles for a particular gene
Its used to determine if a person is Homozygous Dominant or Heterozygous (and thus a carrier of a recessive allele)
Have a go with the interactive by clicking Play
DNA Barcoding
There are some alleles that are very stable within a species but different between species - these are the 'barcodes' that label an organism as belonging to a particular species.
DNA barcoding is a quick way to check for the presnece of different species
